EST details — SGN-E233168

Search information 
Request: 233168Match: SGN-E233168
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C24000Clone name: cLED-6-O24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C186157 is on microarray TOM1: SGN-S1-1-6.1.5.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233168Length: 415 bp (760 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233168 [] (trimmed) AAAAACTTGGCCAAATAATTCCCTTTTCAAACTATCCAATGCTGGATTTAGTTTCTTTAACCCCCCCATTGAATTATTGTTTTACATAAACAAAC
CACAATGCAAATCAAAACTTTCACTAGTTGTTTTCTCCATCAAATTCAACAAACTTTCATATCCTTTTGGGTTTATAGGAGTTGTTTGGGCCCCA
AGTCTTTGGAACATTCTTCCAATAGTATGTGTAATAAATTGGGATCCAGCAGCATACTTGGCATGTTCACTACAACTCATTTTAACCATTCTACA
ACCTTTTTTTACAAAAATGGTGATAAAATTGGTGACTCTTTTAATTCTTGACTTTTCTTGGCCAATTCTAACTTTGGCATACATAAATGGGGGGC
CTTTCCAATTGGCTTTACCACTTGTTGGACCAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233168] SGN-U586965 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50154 [Download] [View] Facility Assigned ID: TOVAV96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.874 Expected Error Rate: 0.0158 Quality Trim Threshold: 12.5