EST details — SGN-E234110

Search information 
Request: 234110Match: SGN-E234110
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60509Clone name: cLEL-8-E24
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60509 [cLEL-8-E24] Trace: SGN-T19168 EST: SGN-E234182 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E234110Length: 327 bp (845 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E234110 [] (trimmed) TTTTTTTTTACAGAATTGAGATCATCAAATTTATTCTCAATCTCGATTAAATCGATATAGAAAGAATTCATACGAGTGTGATATTATTTTCTTAA
GCTAATGGGACTTCCCACTCAGTTTTACACATCAAACATGTAGATAACAAAACTACTGTTGTTCTCAAATTATAACAAAAATGTCTTATTCATAG
ACTTTGCATTCCTCATCAGAAGGATTTGTCTCACAGAACTCATCCAATGGGTCTCCACTTCCTGGTGCTGCAACACCTGGCCATTTGCTTGCTAC
TAGATGAGCCAAGTCCACAACTCTTTGGCTGTATCCTCGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E234110] SGN-U578628 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T19096 [Download] [View] Facility Assigned ID: cC-esflcLEL8E24a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0047 Quality Trim Threshold: 12.5