EST details — SGN-E235278

Search information 
Request: 235278Match: SGN-E235278
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15296Clone name: cLED-11-I17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175455 is on microarray TOM1: SGN-S1-1-4.3.13.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175455 [TUS-21-G5] Trace: SGN-T1371 EST: SGN-E378514 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175455 [TUS-21-G5] Trace: SGN-T190268 EST: SGN-E377077 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235278Length: 681 bp (810 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235278 [] (trimmed) CAAATAAGGTCGAAATTGACGAGAACACAATTCTCAAGGATCTAGATTTGAACTACTGCTTTTATCTAGAGCCTTCTTGGCGTGAAGCTTTACTA
AAGCAGATTGAGATTGACAGCAAATTTTTGGAGCAGCAGCACATAATGGATTACAGCCTCTTGTTAGGTGTTCATTATAGAGCACCCCAGCATCT
ACGATCTCCCATCTCGTGCAGTGGATGTACAACAACAGAAGGATTGGGAATTGTTGCAGATGATGAGTCTCTAGAGGATGAAATATTACCCCAAG
GCCTTGTTTTAGTCCCTCGTGGTGCAGATGATAATTGTGTAGTAGTGGGTTCTCATGTCAGAGGCAGACGATTGCGAACATCATCTGCCACTGGT
GGTGACAAGGAAGTGGATCTCCTCCTCCCTGGGACAGCAAGGCTCCAGATTCAGCTTGGAGTGAATATGCCAGCAAGGGCAGATCATATACCCGG
GAAAGGTGATACACGAATGTTTCTTGAAGTATACGATGTTGTATTGTATGTCGGCATCATTGACATATTGCAAGTATACAATCTACGTAAGAAAA
TAGAACATGCACACAAATCAGTTCTGTTTGATTCTATGTCCATATCTGCTGTGGAACCAACATTTTACTCGCAACGTTTTTTACAGTTCATCCGA
AAGGTGTTTCCTGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235278] SGN-U578843 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51288 [Download] [View] Facility Assigned ID: TOVBO57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5