EST details — SGN-E235587

Search information 
Request: 235587Match: SGN-E235587
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15418Clone name: cLED-11-N8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175525 is on microarray TOM1: SGN-S1-1-6.2.13.12
See unigene SGN-U581535 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C175525 [TUS-21-J3] Trace: SGN-T190533 EST: SGN-E377771 Direction: 3' Facility: INRA
Clone: SGN-C175525 [TUS-21-J3] Trace: SGN-T190534 EST: SGN-E377772 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235587Length: 630 bp (788 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E235587 [] (trimmed) CAAAAACAAAGAATTACTAAACATAAATATCCATTTCCATTACACAATATACATATATATACACACACAAAGAAGAAAGAAGAAAGAAGAAATTA
ATATGGGTAGAGGAAGAGTACAATTGAAGAGAATTGAGAACAAAATTAATCGTCAAGTTACTTTTTCAAAGAGGCGATCTGGTTTGCTTAAAAAA
GCTCATGAGATCTCTGTGCTTTGCGATGCTGAAGTTGGACTCATTGTTTTCTCAACTAAAGGAAAACTCTTTGAGTATTCTACTGACTCTTGCAT
GGAAAGGATTCTTGAAAGGTATGAAAGGTACTCATATGCTGAAAGGCAGCTTAATGCTACTGATATTATAACCCCGGGTAGCTGGACTTTGGAAC
ATGCTAAGCTTAAGGCCAGACTTGAGGTTTTGCAAAGAAACCAAAAGCATTATGCAGGAGAAGAGTTGGACACATTGAGTATGAAAGAGCTTCAG
AATCTGGAACACCAGCTCGATTCTGCTCTTAAGCACATTCGATCTAGAAAGAACCAATTGATGCATGAATCCATTTCTGAGCTTCAAAAGAAGGA
CAAGGCATTGCAAGAACAAAACAACAATCTTTCAAAGCAGGTTAAGGAAAGGGAGAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235587] SGN-U581535 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51597 [Download] [View] Facility Assigned ID: TOVBR76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5