EST details — SGN-E236512

Search information 
Request: 236512Match: SGN-E236512
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15562Clone name: cLED-13-E3
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175595 is on microarray TOM1: SGN-S1-1-8.1.13.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175595 [TUS-21-M1] Trace: SGN-T190353 EST: SGN-E377162 Direction: 3' Facility: INRA
Clone: SGN-C175595 [TUS-21-M1] Trace: SGN-T190354 EST: SGN-E377163 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E236512Length: 447 bp (782 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E236512 [] (trimmed) AAAATACTTTGCGTGAGTTGCTCTTACTGGTCAACTCTTCTTCTTCAAATCTCAAATCTCAAATCTGAAATATCAGAGAGGGACTGAGGGGTCAC
AGAGCAATGGGGGCATTAACAACGGCGCTGATAGCAATTGGAGGCGTAGTTCTCGGCTGGATCACCATCGAGATGGCTTGCAAGCCTTGTCTTGA
AAAAGGTCGAGAAGCCATTGATCAAAATCTCAACCCAGACTATGACCCAGATGATCAACACAGTATCCGGGAACCTCTAACTGCAAACGCAACTC
AAGACACCGATCCGGATTCCGCTTCTTCAACTGCCGTTAAAATTGTCTGATCATATCCTATTCTCCTCCCTATTTTGCTTGACTGCAATTGCCCC
CCTTACAATGCTTTTTTTTTTTTTTTTAAGTTTGGAGTCTTAAGAGGGGTAATCGAAATATAAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E236512] SGN-U579861 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51790 [Download] [View] Facility Assigned ID: TOVBW26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0133 Quality Trim Threshold: 12.5