Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E237326

Search information 
Request: 237326Match: SGN-E237326
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60331Clone name: cLEL-7-N15
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60331 [cLEL-7-N15] Trace: SGN-T18578 EST: SGN-E237214 Direction: 3' Facility: Cereon
Clone: SGN-C60331 [cLEL-7-N15] Trace: SGN-T22523 EST: SGN-E280060 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237326Length: 324 bp (823 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E237326 [] (trimmed) AAAGCAAGAAATTCTTATTTCCACAAAGCATTCTTGATACAAAGTTTGATATTAGCGACTACAGATATATCAAAAACATTATTGGCATAGATTCT
AGAAGCTCATTGTAGAGCCAGAACACTTGGGAGGCAGTAGTGATAAGCTTAAAGAGCATTGACTATTTCATCAGCACCGGACACCGGGAACTCCC
CTTCAGATACAATGTTAGCTACTTTCACCTCACGGTCATGAACCAAAAGAGCATACCTTACCTGATCGAACACCAAGCCCCTTATCCGACAGATC
AAGCTACAGCCCAAGGGCATAGGGAGTATTTTCCAGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237326] SGN-U579086 Tomato 200607 Build 2 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T18690 [Download] [View] Facility Assigned ID: cC-esflcLEL7N15d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0246 Quality Trim Threshold: 14.5