EST details — SGN-E237536

Search information 
Request: 237536Match: SGN-E237536
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17333Clone name: cLED-19-F23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184912 is on microarray TOM1: SGN-S1-1-3.1.12.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184912 [TUS-46-A6] Trace: SGN-T1856 EST: SGN-E378639 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237536Length: 343 bp (813 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237536 [] (trimmed) GATTTATCCAAAACCAAGAGCAATTGGAACCTATGAGATCTCACAAGTTGTTGAAGATTATCGCAGGTCGGCCTTGAATGCTATTGAAGCAGGTT
AGCTCATTCTTTATGTAAATCATGTACCAATGGGCATCTCTGTTTGAAATCCTATGACATCTTTTTCATTGTGTAAGTATTGAAGTTCATACAGT
TGAGTTATTTCTGCTCACAAAAAGGTTAACCAGAACGGAACCTTCATTTCATCCTGTAAAGTGTCATTCAGCAGACCGTATTAGAATAGTATTGA
ATAGGCCGATGTATTATTAATGTTGACATTACTTGGGCTAGGATTTTTTTTTTTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237536] SGN-U576938 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53450 [Download] [View] Facility Assigned ID: TOVCW36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0229 Quality Trim Threshold: 14.5