EST details — SGN-E237599

Search information 
Request: 237599Match: SGN-E237599
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17231Clone name: cLED-19-A9
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175857 is on microarray TOM1: SGN-S1-1-2.3.11.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175857 [TUS-22-G23] Trace: SGN-T180447 EST: SGN-E367833 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237599Length: 481 bp (858 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E237599 [] (trimmed) CTCTTTACATTACAACTAAAACCAAAATGGAGTCAAAGTTTGCTCACATTATTGTTTTCTTTCTTCTTGCAACTTCTTTTGAAACTCTCAATGCG
CAAAGAAATGGACTAGAATTCATAAAACTTGTAAAGGAATTGAAATCGGTTCATGAGCCCAAGCCCAACTTGGAATGTCAAGGAAAACTAATGTG
GCCAGAACTTATTGGTGTACCAGCACAATATGCTAAGGGAATAATTGAGAAGGAAAATCCACTTACTCATGTTCAAATAGTATTGAATGGTTCTC
CAATCACAACTGATTTAAGTTGTAATCGAGTTCGAATTGCTGTAAACATCTTGGATTATGCTGTATCAATGCCTGTGGTTGGTTAATTAATGGAT
TATTGAAGTAAGAAGCCACATGTAAAAATATAATTAGGGTTCATGTATGTTAATCATAATGTATCCATGTACTCCTACTATATATAATGGAATAA
ATAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237599] SGN-U592087 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53513 [Download] [View] Facility Assigned ID: TOVCU05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0057 Quality Trim Threshold: 12.5