EST details — SGN-E237668

Search information 
Request: 237668Match: SGN-E237668
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17387Clone name: cLED-19-I14
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175924 is on microarray TOM1: SGN-S1-1-7.2.11.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175924 [TUS-22-J18] Trace: SGN-T180845 EST: SGN-E368663 Direction: 3' Facility: INRA
Clone: SGN-C175924 [TUS-22-J18] Trace: SGN-T180846 EST: SGN-E368664 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237668Length: 431 bp (727 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E237668 [] (trimmed) AATGAACGGGATGGAATTAACTGCTGATGTCATTTGTTACACTGTTTTGATTGATAGTCACTGTAAATCAGACAACATTGATGATGCTATTCACC
TTTTCACTGAAATGATTGATAGAGGTTTAGAACCTGATAGTGTGACATACACAGCTCTAATATGTGGCTATTGTAAGCAAGGACATGTTGAGATG
GCTAAAGAACTTGTGAATGATATGTGGAGAAAGGGAATACAACCAGATAGCCATACCATCTCAGCACTACATCATGGAATCATAAAGGCCAAAAA
GTTGCACCTTAGGCATGACAATAACTCAGCCCAAAATCGGAGACTGCAGGTTATCTAGTGTAGTTTTGGCAAGGCACAAGTTTGTTGCATGAGCA
CATACTTTGGTAATACTGGAAAGAGAAGAGTTGGTGCTCCTGATGTAACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237668] SGN-U603293 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53582 [Download] [View] Facility Assigned ID: TOVCV55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5