EST details — SGN-E237726

Search information 
Request: 237726Match: SGN-E237726
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17286Clone name: cLED-19-D20
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185900 is on microarray TOM1: SGN-S1-1-7.2.7.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185900 [TUS-48-J10] Trace: SGN-T192749 EST: SGN-E391423 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237726Length: 603 bp (842 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237726 [] (trimmed) CTCAAACATCTAGATTTTTGTGTTTCACTTTTTATACGAAAGAGAAAAGGGGTTTTATATTGGCTCGATTAATTGGTTACCTGAACTCTCGATTT
ATTATTTTGTAATCTCCTCTCTTTTGTTTTCTATTTTTCCAACCCTAATTTTTTTAAAAAATTCTTTTTTAGTTGAATTGAATACAACATATTGA
ATATTGAGAATCGCAAGCTCACTTACATTATGCTTTTTATTTTCATAAATATTTGAACAACATATTTAATTAATTAAAAAAAAAATACCTATTGT
ACTAAAATTTTATTTTAATAAAAAAATTATTGCTTAAGAGAAATGATTATCGTTCACATTTAAATGAGAAATATTGAAAAGAAAAATATTTATCC
TTCTCCCAAAGGGAAAAGGTATTTGTTTACTTTTTATTTTATTTTGGTAACTTCCCTAATTAAATTTGAAGTTCCTAAGTCGTATTGGTTTAGAA
TTTGCTTAACTCTTATAAATATATAATAAAGATCGTTTGAGATTATTATTATTTCGTTCTCGATCAATGGTCTCAAATCACAATATTCATTATCA
TAATAAATATGGAAACTATGTTCTATCACAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237726] SGN-U584880 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53640 [Download] [View] Facility Assigned ID: TOVCX22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.880 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5