EST details — SGN-E238028

Search information 
Request: 238028Match: SGN-E238028
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17048Clone name: cLED-18-H16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181141 is on microarray TOM1: SGN-S1-1-6.4.15.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181141 [TUS-36-D3] Trace: SGN-T193841 EST: SGN-E392515 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238028Length: 388 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238028 [] (trimmed) CTTAAGAGGATATCTGATATTTGTAAGGAAGTTGGATGTTGGCTCGTAATTGATAACACATATGAGTATTTTATGTATGATGATCGCAAGCATGT
TTGCATAGAAGCAAACCACATTGTCAACATCTTTTCCTTCTCCAAAGCATATGGGATGATGGGATGGCGAGTTGGATATATAGCATACCCATCGG
AAGTGTAAGGGCTTGCAGTTCAACTCCTTAAAGTTCAGGACAACATACCGATTTGTGCTTCAATAATCTCACAACGACTGGCTCTCTACTCAATG
GAAATGGGACCAGAATGGGTAGCTAATCAAGTTAAGGACCTTGTCAAGAACAGAGAGGTGCTACAAGAAGCCTTATCTCCTTTGGGAGAGGGGGC
TGTTAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238028] SGN-U567390 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53331 [Download] [View] Facility Assigned ID: TOVCT44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5