EST details — SGN-E238205

Search information 
Request: 238205Match: SGN-E238205
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18336Clone name: cLED-22-O9
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169514 [TUS-5-O16] Trace: SGN-T351106 EST: SGN-E550231 Direction: 3' Facility: Avesthagen
Clone: SGN-C169514 [TUS-5-O16] Trace: SGN-T351349 EST: SGN-E550474 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238205Length: 448 bp (876 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E238205 [] (trimmed) TTTAATTTTGAATATGACTTATCGAATGTTATTTGGGGATGGGAATAGTGAGAGATTTGATTTGGAGAATATTGTAAAGGAGATGGTAAGATTGG
CTGGAATTTTTAATGTTGCTGATTATGTGCCTTTTCTTGAGCCATTTGATATTCAGGGCTTGAATAAGCAGTTGAAAGAAGCAGGAAAGCGTGTT
CAAGAAGTATTTGATACCATAATCAATGAGCATGAACAAGATGCTAGGAACTACACTCACAAGAGCAAAAACAAGGATCTTGTTGATATCATGTT
GTCATATCAAGACAATCCGAACTCATCCTACTCGATTGATCGTGCAACCATGAAAGCTATCCTTTCTGACATGATCGTTGGAGCCATCGATACTT
CACACACTTGGATAGAATGGGTGTTTGCAGAAATCATAAAGCATTCGACAGTTATGAACAAACTCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238205] SGN-U598648 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54271 [Download] [View] Facility Assigned ID: TOVDG89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5