EST details — SGN-E238500

Search information 
Request: 238500Match: SGN-E238500
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C16852Clone name: cLED-17-M21
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175816 is on microarray TOM1: SGN-S1-1-3.2.11.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175816 [TUS-22-F6] Trace: SGN-T180823 EST: SGN-E368641 Direction: 3' Facility: INRA
Clone: SGN-C175816 [TUS-22-F6] Trace: SGN-T180824 EST: SGN-E368642 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238500Length: 436 bp (1133 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E238500 [] (trimmed) CAGGATGGTTGGGTGATAGAAGAGGTACCACGTACAGACGGAAGCAGCATGGTGGATAAGTATTACTATGAACCAGGTAGTGGACAAAAATTTAG
ATCCAGGATAGCGGCACAAAGATACTTGGCTCAAATGAGAGAAAATGTTCCTTTGTCCGCTACTCTAGAAGAATTGAAAGAGAATAAACCACTGT
CCAAGATGTTTAAGTTGTACCATCATGCAAAGAAATCTCTTCCATGTAAGAGGAACATCGTTACAGAGAATTCATCGTTTCTTTCTCCACCAGCA
AAAGTAAATTGGGTTCTTTCTAGTCCTAAAGGGGATGCTTGGAATCCTTTGATTTCTGGAACAGCTATTCCTGATTCACTAAAACAACAATGGAC
TAAAAGAATCAAGTTGTTCATGAATGACGAGAACCTGAATGCATGAAAGTCAGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238500] SGN-U586525 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52942 [Download] [View] Facility Assigned ID: TOVCM83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0190 Quality Trim Threshold: 14.5