EST details — SGN-E239929

Search information 
Request: 239929Match: SGN-E239929
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20101Clone name: cLED-29-E22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181440 is on microarray TOM1: SGN-S1-1-3.4.14.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181440 [TUS-36-P14] Trace: SGN-T194219 EST: SGN-E392893 Direction: 3' Facility: INRA
Clone: SGN-C181440 [TUS-36-P14] Trace: SGN-T199272 EST: SGN-E397946 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239929Length: 472 bp (687 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239929 [] (trimmed) GAAATGCTGAAGCAGTTATCCTCTGCCCCGAGTCCTGGTCAGGAGAAGGTTCGACAGCAAGGCGAGTTTGAATGTTTGTATCGAGACCTGATAGT
TGGTTTCGGAAACTGGGACTTCTTTCCGACGGATATCACAAATCCTTTTCCAGATAACGAAGGTTCGGTCCATCTTTGGCAAGGACACGATGACA
GAATTATTCCGCGTGAACTCAATCGTTATCTAGCAGAGAAGCTCCCATGGATTCAATATCATGAGGTTCCTAATGCTGGACATTTGTTAATGCAC
AATGCTAGTTATTGTGAAACCATCTTGAGGAAACTTTGCACTAGTTGAACGGGAGACTTGGAGCAACAGTAAAGTAAAGTTGTCTCCGTGTGACC
TATACGTCACATGGAAGCAATCAATAATGCTTGAACCAGGGTAAGCTATCCACATCACATCTGTTATAAGGTGCGACCCTTTTCCGAGCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239929] SGN-U577685 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56217 [Download] [View] Facility Assigned ID: TOVEJ35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5