EST details — SGN-E240837

Search information 
Request: 240837Match: SGN-E240837
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18614Clone name: cLED-24-B10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175981 is on microarray TOM1: SGN-S1-1-6.1.11.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175981 [TUS-22-M3] Trace: SGN-T180462 EST: SGN-E367848 Direction: 3' Facility: INRA
Clone: SGN-C175981 [TUS-22-M3] Trace: SGN-T180463 EST: SGN-E367849 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240837Length: 340 bp (831 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240837 [] (trimmed) TCAACAATAGATGTAGTGGCTAAGGTGCTCTGTGACAAAAGTGGAGTTTTTGATGCCTTGGAATTCGTGAGAGCTGTAATAAAGAAGCACGATAT
TGTACCAAGAAAGACAACGTATGAACTTCTGATACAGAGCTTGTGTAAGGAGGGGTGGATGGAAGAAGCTCTGAAACTTCATGTAGAGATGGTGG
GCAAAGGATATGAACCAAATTTTGAAATATATAGTGCTTTCATTGATGGGTACATCAAGCAAGGGGATGAAGAAAAGGCTGAAACTTTGAGGAAT
GAAGTGCTCAGGAATACGATACCATGTAAAGACAGCTAGAAGTTGAGTCTTGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240837] SGN-U570436 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54734 [Download] [View] Facility Assigned ID: TOVDR05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5