EST details — SGN-E241526

Search information 
Request: 241526Match: SGN-E241526
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C19829Clone name: cLED-28-D22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169244 [TUS-5-D10] Trace: SGN-T351294 EST: SGN-E550419 Direction: 3' Facility: Avesthagen
Clone: SGN-C169244 [TUS-5-D10] Trace: SGN-T351321 EST: SGN-E550446 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241526Length: 478 bp (914 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E241526 [] (trimmed) GATAAATGCTTGGAGAAACCTTGAGGCATTTGGGAGATTATAAAGGAAAACATTTCAGGTGTGGAAGTGGGGAAAACGTGAAGAGGTATTTCATT
TCCGTGGGTATAATTAATGATGAAATAGCTCCTTGCCACGTGACTTAAGAAGGGACTTTGGAAATTGATCCAAAAGTACAACTTAGCTAGAGTCT
AAATAAGAAATAACCGATCAGAAAGGATTTAGGATTGGAATTGATAGATGCGTGCTTAGGATTTAGAATTTAGGGATTAGATAGAGGAAGAGATA
AGAAAGTGTATAGGCTCGTCAAGTAAAATAGAAGAGGATCTGAGATCTAAACTTAGTGAAGTATATTAAAGACCAGAAAATCATGGAATTGATGG
AAAAGACATGTATGCATAACAGAGAGCTAAATCTAAGATTAGAAACATATACAACTTATCAATATTTATAATTATAAATACAACAAAATAATGAT
GAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241526] SGN-U600784 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56004 [Download] [View] Facility Assigned ID: TOVEH23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0167 Quality Trim Threshold: 14.5