SGN ID: SGN-C25298 | Clone name: cLEE-2-M20 |  | Order Clone |
|
Library Name: cLEE | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E243237 | Length: 216 bp (828 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E243237 [] (trimmed)
GCTGAATTTGTTACATGGTTTCAGATTAAATGACTCTGTAATATGATATATGATCACCATAGGTCTTTTTGCAGCCTTTGAGGGTGTCTGTGTGG
AGTTTGAAAAAGTTGGTGATTGTAAGAATGAGCCTTTACTTCATAAGAACTTTAGGATAAAGGACTTGTTATTGTAGGTATAATTATAATTATGC
TATCATTGCTATTACTCCGTTCATTT
[BLAST] [AA Translate]
SGN-ID: SGN-T58800 [Download] [View] |
Facility Assigned ID: TSEAF82TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.881 |
Expected Error Rate: 0.0024 |
Quality Trim Threshold: 12.5 |