Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E243237

Search information 
Request: 243237Match: SGN-E243237
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25298Clone name: cLEE-2-M20
cartOrder Clone
Library Name: cLEEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243237Length: 216 bp (828 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E243237 [] (trimmed) GCTGAATTTGTTACATGGTTTCAGATTAAATGACTCTGTAATATGATATATGATCACCATAGGTCTTTTTGCAGCCTTTGAGGGTGTCTGTGTGG
AGTTTGAAAAAGTTGGTGATTGTAAGAATGAGCCTTTACTTCATAAGAACTTTAGGATAAAGGACTTGTTATTGTAGGTATAATTATAATTATGC
TATCATTGCTATTACTCCGTTCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243237] SGN-U585797 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58800 [Download] [View] Facility Assigned ID: TSEAF82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.881 Expected Error Rate: 0.0024 Quality Trim Threshold: 12.5