EST details — SGN-E243437

Search information 
Request: 243437Match: SGN-E243437
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21506Clone name: cLED-34-E14
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176202 is on microarray TOM1: SGN-S1-1-1.2.11.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176202 [TUS-23-F8] Trace: SGN-T181430 EST: SGN-E368503 Direction: 3' Facility: INRA
Clone: SGN-C176202 [TUS-23-F8] Trace: SGN-T181431 EST: SGN-E368504 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243437Length: 397 bp (800 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243437 [] (trimmed) GAGCAATTAACAATGGCTTCAAATGCCTCAATTTTCACCCGCAATTCTCTCTTATCTGTACAGGTCGTGGGGTTTCCCCGATTACCCGTTTCTCA
ACTCCATGCCCGAACCCGAATTCAGCCAAACCCACCTCATACAACCCGACTCGGACTGTCTTCTTCTTCTATCAGTTCTTCAACTAATGGATTGA
AAAGTTTGTATCTTTCTGATGTTGGGGCTAGATGGTTTGTTTCTAGAAGTAAGTTTCAGATGTCAGCGGTTTCAGGCGACGGAGGTGGTGGTTAT
GGAGGTTCCGGTGATGGAAATTCAGGTGGTGGTGACAATGGAAGTAACAGCGGNGGTGGTGAGGGTGGGAAGAACTGGTCATTGCTTGCCTGGTA
CTTATCTCTGCTTGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243437] SGN-U575926 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57211 [Download] [View] Facility Assigned ID: TOVFD31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0104 Quality Trim Threshold: 14.5