Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E243993

Search information 
Request: 243993Match: SGN-E243993
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25077Clone name: cLEE-1-K15
cartOrder Clone
Library Name: cLEEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243993Length: 430 bp (797 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E243993 [] (trimmed) CAGGTTCTGCGGTCCCATTCCTTCAGAGATTTGTAGTTGGACTCCATATTTAGTAAAACTCGACTTGTCAGTTTCTCTGGCTCTATACCTGCTGA
ACTTAGAAACTGCACCTACTTGACCAAGTTGATTCTCAATAACAACAAACTATCTGGAAATATTCCACCAGAAATCTCTCAATTAACAAGGCTCA
AGGTGCTCTCCTTGGCTAACAATAATCTTTCTGGTAACACACCACCATTCTCAGGTTGAAGATGGCAGATAGTTAGCCGAGTTTTGGCTAAATGT
ATCTGACATTTCATATTTGTATTGTATGGTGAAAATGTCTGCAATTCCATGCTTCCAGTTAACAAATGCAACATCAACTTCTTTCTGTGTCTATT
CGACAAAGTTTTTGTACACAACACAAAGGAACAGAAAGTGTTGATACTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243993] SGN-U597031 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58442 [Download] [View] Facility Assigned ID: TSEAA68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5