EST details — SGN-E246294

Search information 
Request: 246294Match: SGN-E246294
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26415Clone name: cLEF-40-F11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176309 is on microarray TOM1: SGN-S1-1-6.2.10.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176309 [TUS-23-J19] Trace: SGN-T181305 EST: SGN-E368378 Direction: 3' Facility: INRA
Clone: SGN-C176309 [TUS-23-J19] Trace: SGN-T181306 EST: SGN-E368379 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246294Length: 458 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246294 [] (trimmed) CAGGCAAAAGTTTGAGTATATATCACTGCAATAGGTTCTCAATATGCCACACAAATAGGAAAGAAATGTATGTCCACTATACATTTTTCTTCTGA
GTTCTTTAGTGATATATGCATCTTAACAGACACTTTTAAGTGTCACTAATAGGTATTGCTACAAGCAGTTTGGACCTTCAACTATAAATAGCTTG
TCATTATCTCTTATTACTTCAATTGAGTCAATTTCTGATCCTTCTTGATCCGTAATCGATGCATTTGTTGCATCAAATCCAAATTTCTGACCTGC
AATGATCTTGAGCTCTGCAAGTGAATTTGGAAGCGTAATTAATTTGCCAGGTTCACTGCAATGAGTTCTTCTCCTGATAACAGGATGGCCTCTGT
ATATGCTAACTCTAAAAGACATTTGATCCCTAGTGCTTTCTGAATTGTGTTGCTTCTCTTGTTGGCGCCATTTTTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246294] SGN-U568026 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60146 [Download] [View] Facility Assigned ID: TMGGC30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5