EST details — SGN-E247194

Search information 
Request: 247194Match: SGN-E247194
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27964Clone name: cLEF-46-C21
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176826 is on microarray TOM1: SGN-S1-1-1.4.9.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176826 [TUS-24-P8] Trace: SGN-T197540 EST: SGN-E396214 Direction: 5' Facility: INRA
Clone: SGN-C176826 [TUS-24-P8] Trace: SGN-T199893 EST: SGN-E398567 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247194Length: 327 bp (424 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247194 [] (trimmed) CAGTCGTGTTGGTACTGCTGATCAGTCCTCGGTTCCCTCTGTTACTCAGAGAGTTGCCAGGACCAATGCTGATATCCCAAGACCAGGATCTTTTG
TCCCTCCATTCCTTGTTGGTCACGGTTCTGCTGCCAGAGCTGGAAGTTCAGTTGCTTCACCAATGATACCTCCTTATCCTGGAAGTGTAGCTCGG
GCTCGTGACCGTGTTCAAGCTCTTCAAGCCTATTTTCAGCAACCAAGTAATTCACCAGCTGTACGCACTCCTGTTATGTCTGCTACTCGACGATC
CAACAATCACAGAGGGTTGGCTCAAGTGGGGCCGGCTGCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247194] SGN-U580180 Tomato 200607 Build 2 39 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61605 [Download] [View] Facility Assigned ID: TMGGY23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5