EST details — SGN-E247280

Search information 
Request: 247280Match: SGN-E247280
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28163Clone name: cLEF-46-M13
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176915 is on microarray TOM1: SGN-S1-1-8.4.8.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176915 [TUS-25-D1] Trace: SGN-T181957 EST: SGN-E369004 Direction: 3' Facility: INRA
Clone: SGN-C176915 [TUS-25-D1] Trace: SGN-T181958 EST: SGN-E369005 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247280Length: 329 bp (427 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247280 [] (trimmed) GCAAACTGTGATTCGGAAGCTCTTCTTCATCTACAATTTTCCCTATGCGCTCGACGAATTGCTTGAAATTCGGGATCGAACAAGTGTAGGAAGCA
TACATCATGGCCGCGATCGGAGCAATGCCGGAGATTGGTGGCTTCCGACAGAAAAGCCGAAGGTCATTTGTAACACTTATTCTGACAGTTCTTAC
GAGTTCACAATCGATTCTCATTGTTTGGTCGAAGAGAGCTGGGAAGTATGAGTACAGTGTAACCACTGCAAATTTTCTGGTAGAGGCATTGAAAT
GTGCATTGTCGCTTGTGGCCTTGCTAAGAATCTGGAGAACGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247280] SGN-U567918 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61691 [Download] [View] Facility Assigned ID: TMGGY79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0006 Quality Trim Threshold: 14.5