EST details — SGN-E247296

Search information 
Request: 247296Match: SGN-E247296
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28092Clone name: cLEF-46-I22
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C183046 is on microarray TOM1: SGN-S1-1-5.3.3.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183046 [TUS-41-C12] Trace: SGN-T191745 EST: SGN-E390419 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247296Length: 407 bp (1085 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247296 [] (trimmed) TGAATTTGATGATTATTGGTGATGGCATGTATGCTACCATCATTACTGGGAGCCTTAATGTTGTCGATGGATCAACAACCTTCCACTCTGCCACT
CTTGCTGCAGTTGGCAAAGGATTTATACTACAGGACATATGTATACAGAACACAGCAGGACCAGCTAAACACCAAGCTGTTGCACTTCGAGTTGG
AGCTGATAAGTCTGTCATAAATCGTTGTCGTATCGATGCTTATCAAGACACCCTTTATGCACATTCTCAAAGGCAATTCTATCGAGACTCCTACG
TGACAGGGACTATTGATTTCATATTCGGTAATGCAGCAGTTGTATTCCAGAAATGCCAGCTCGTAGCTAGAAAACCGGGTAAATACCAGCAAAAC
ATGGTGACTGCACAAGGCAGGACGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247296] SGN-U563073 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61707 [Download] [View] Facility Assigned ID: TMGGZ59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5