EST details — SGN-E248926

Search information 
Request: 248926Match: SGN-E248926
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28955Clone name: cLEF-49-L19
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177082 is on microarray TOM1: SGN-S1-1-1.2.8.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177082 [TUS-25-J24] Trace: SGN-T182149 EST: SGN-E369660 Direction: 3' Facility: INRA
Clone: SGN-C177082 [TUS-25-J24] Trace: SGN-T182150 EST: SGN-E369661 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248926Length: 536 bp (918 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248926 [] (trimmed) CTGCAGGCTTTAGGAACTAGCACAAATAAGGAAAAATTTATCCATAAACTTTGAATTTATGATGAGTGTTGTTTTTGATGCAGATTTCAAGCGTA
TTTTTTCATGAGCATAGAATAAATAGGGTGAATAAACTAACTTTCATATGAAATTATGCCGCAGCAATTTTGTTTTCAAGTGTATTTTTTCATGG
GCGTAGAAGAATTTGGTGAATTTACTAATTTTCTCTCGAATTCTGCGCAGCATTTTACTTTCAGGTGTATTTTTTCATGAGCGTAGAAGAAATTG
GGTGAATTTACTAATTTTCTCTCTAATTCTCCGCAGCATTTTGGTGAAATAGCGTAGAAGAAATTGGATCAAGTTAATAAGTTTTCGCCTCCGCA
GGATTTTGGAGGTGAAATTTCAGTTTTATCGAGTAGGTGATATTTTACGTCTTCTCTCGAGTTCTCCGCGGCATTTTGAAGACAATCACCCAAGC
AAGTTTAGCAAAAGTTGCATGCGAGACAAAGGTTACCTTGGAAATGCAAGTTGCACCTACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248926] SGN-U586271 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62434 [Download] [View] Facility Assigned ID: TMGHM70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0177 Quality Trim Threshold: 14.5