EST details — SGN-E249593

Search information 
Request: 249593Match: SGN-E249593
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C29996Clone name: cLEF-56-A24
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249593Length: 543 bp (770 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E249593 [] (trimmed) GCAAGTGTACCAGCTGTCACTAAGAATGATGGGAGTAATAAGAGGGAGCCTGAGGTTATGGTTTCAGGGCAAGGAACAGAAAAATCTGGTGCTTC
TTCAAGCAAGAGTGAAGACAGCCTCCGGTCTCCTATTTGCTGTATCATGGGTCATGTTGATACTGGTAAAACCAAGCTTCTTGACTGCATACGAG
GCACTAATGTCCAAGAAGGTGAAGCTGGAGGGATTACACAGCAGATAGGTGCAACTTATTTTCCAGCTGAGAATATAAGGGAGAGAACAAAGGAA
CTAAAAGCTGATGCCAAGCTGAAGGTGCCTGGATTGTTGGTCATAGACACACCTGGCCATGAATCATTCACTAATTTGCGTTCTCGGGGTTCAGG
TTTATGTGATATTGCAATTTTGGTTGTGGACATTACGCATGGGTTAGAACCGCAGACTATCGAGTCGCTTAATCTTCTAAAGATGAGGAATACAG
AATTTGTTGTTGCTCTGAACAAGATAGATAGGCTTTATGGATGGAAAGTGTGCCGCAATGCACCTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249593] SGN-U589619 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T63722 [Download] [View] Facility Assigned ID: TMGIN12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0027 Quality Trim Threshold: 20.5