EST details — SGN-E251424

Search information 
Request: 251424Match: SGN-E251424
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C45799Clone name: cLEG-9-E22
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188007 [TUS-54-B5] Trace: SGN-T351741 EST: SGN-E550866 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E251424Length: 578 bp (959 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E251424 [] (trimmed) GAAAATGGACCCAAAGCTGCTGATTTTATTAAGGATGCTATGTCTAGCTGGCCCCCTCTGCGACCATTATGCTTGATTTTGAAAGTGTTCTTGCA
ACAGAGAGAGCTAAATGAGGTTTATACTGGTGGGATTGGATCCTATGCTCTGCTTGTAATGCTCATAGCAATGTTGCAGAACCATCGAAATGGCC
AAGCTTCTGTGGAGGAGAATCTGGGAATTCTTTTGGTTAATTTCTTTGATATTTATGGACGCAAACTAAATACATCAGATGTTGGTGTATCTTGT
AATGGAGAAGCTACCTTCTTCCTGAAGAGTTGCAAAGGGTTCTCAATTAAAGGAAAGCAATCTCTCATCTCCATTGAGGATCCACAGACACCAGA
AAATGACATAGGCAAGAGCTCCTTCAATTATTTTCAGGTCAGATCTGCTTTTTCAATGGCTTTCACGACATTGACAAATGCAAAAGCCATATTTG
CCCTTGGTCCCAACAGGAGTATACTTGGCACAATAATTAGACCCGATGAAGTACTAGTGGAAAGGAAAGGAGGATCTAATGGGGAAGTGACTTTT
ACTAACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E251424] SGN-U579832 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T65507 [Download] [View] Facility Assigned ID: TBFBH35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0014 Quality Trim Threshold: 20.5