EST details — SGN-E254109

Search information 
Request: 254109Match: SGN-E254109
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C35438Clone name: cLEG-34-P23
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180837 is on microarray TOM1: SGN-S1-1-6.3.17.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180837 [TUS-35-G11] Trace: SGN-T187484 EST: SGN-E375716 Direction: 3' Facility: INRA
Clone: SGN-C180837 [TUS-35-G11] Trace: SGN-T187485 EST: SGN-E375717 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254109Length: 553 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E254109 [] (trimmed) AAAGTACCTCAAATATTCGTTCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCGA
TGAGGATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGAGATGCATCGCAGAAATGGGGTCACTTGCTCATAATCCCACTGAAGCTGAACT
ACAGGATATGATCAGTGAAGTTGATGCTGATCAGAATGGAACCATTGATTTTCCAGAGTTCTTGAATCTGATGGCACGGAAGATGAAGGACACTG
ATTCTGAGGAAGAACTCATAGAGGCTTTTAAGGTTTTTGATAAAGATCAGAATGGCTTTATTTCTGCAGCTGAGCTTCGTCATGTAATGACAAAC
CTTGGAGAGAAGCTGACTGATGAAGAGGTGGATGAGATGATCCGAGAGGCAGATATTGATGGTGATGGACAAGTTAATTATGAGGAGTTTGTCCG
TATGATGCTTGCCAAGTGATGACTTTAAGATTCTGTTAGCTACTATGTAATCTATGATAGCTGCTCAGTTAGTTACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254109] SGN-U579995 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70167 [Download] [View] Facility Assigned ID: TBFFE96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0115 Quality Trim Threshold: 12.5