EST details — SGN-E254490

Search information 
Request: 254490Match: SGN-E254490
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C33963Clone name: cLEG-29-C17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180622 is on microarray TOM1: SGN-S1-1-5.2.19.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180622 [TUS-34-N12] Trace: SGN-T187265 EST: SGN-E375497 Direction: 3' Facility: INRA
Clone: SGN-C180622 [TUS-34-N12] Trace: SGN-T187266 EST: SGN-E375498 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254490Length: 409 bp (991 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E254490 [] (trimmed) GCACCTAGGAGGACATCCAATCAGATATATATGGTGCTGATTATCCTTCTTAGACTTAGCCAAGATTCCTCATTCAATGCCAGCATTCATAAACT
GGTGCTGCCCAGTGTTCCATGGTACCAAGAGCGTGTTCTTCATCAGACCTCTCTTGGTTCTCTTATGGTCATAGTTTTGACGAGGACAGTGAAAT
ACAACCTATCTAAGTTGCGGGATGTTTACCTTCATACAAATTGCCTTGCAACTTTAGCTAATATGGCACCTCATGTACATCGCCTAAGTGGTTAT
GCATCACAACGTTTAGTGAGCCTATTTGACATGCTTGCACGCAAGTACAACAAATTGGCAGAGATGAAAAATGATAAGATGCATGTGCTCAATGG
TGAATCAAAGGAAGAAAATAATCTCCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254490] SGN-U578643 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68756 [Download] [View] Facility Assigned ID: TBFEI21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0170 Quality Trim Threshold: 14.5