EST details — SGN-E255322

Search information 
Request: 255322Match: SGN-E255322
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34183Clone name: cLEG-30-A20
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180664 is on microarray TOM1: SGN-S1-1-3.4.19.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180664 [TUS-34-P6] Trace: SGN-T187273 EST: SGN-E375505 Direction: 3' Facility: INRA
Clone: SGN-C180664 [TUS-34-P6] Trace: SGN-T187274 EST: SGN-E375506 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255322Length: 583 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255322 [] (trimmed) TTATTGTTGACAGTTTGTAGTGCTCCCAAACGGTTAGTGGTTAATGAAAAAAATGAAAACAAAGAAGAGTCTATATCTTACTATATTTGTAATAT
TTGAAAAACTTAGTGCAACTTGCTTGGTATTTCTTGCAGATTATCATGCCAAGACTAGGTTGGAGATGGTTATTGGCTTTATCGTCTATACCATC
ATTTGCAGCTTTTCTCTTGTACATTTTTACTGTAGAGTCTCCTAGATATCTATGTGCCGAAGGTAGAATAACTGATGCACATGATATTTTGAGGA
AAATAGCTGTTGTTAATCAGACAAAACTTCCCCCTGGGATGCTTGTTTCTGATCAAGTGATAGAGCTGGATGAGGAACAGAAATTGCTTAGGCCG
AGAGCCAACAAAATCTTCAATTTTAAGACAGGATTGTCTTCATCCCTGATGCTTTTATCCCCACAATTACTACGAATTACCCTCCTCATGTGGGT
GGTTTATTTTGGAAATTCATTTGCCTATTATGGCATTATATTGCTGACATCACAGTTTAGTGCTGGGGAAAATAGATGCTTCTCAGTTGCTTTGC
ATGTGAAAAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255322] SGN-U568306 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69048 [Download] [View] Facility Assigned ID: TBFEN10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5