Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E255393

Search information 
Request: 255393Match: SGN-E255393
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34428Clone name: cLEG-30-N5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C182390 is on microarray TOM1: SGN-S1-1-5.4.8.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182390 [TUS-39-H4] Trace: SGN-T191540 EST: SGN-E390214 Direction: 5' Facility: INRA
Clone: SGN-C182390 [TUS-39-H4] Trace: SGN-T191764 EST: SGN-E390438 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255393Length: 634 bp (839 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255393 [] (trimmed) TTAGTCGTAACTTTAGTCAAACTTCGTAATAATTTAGTAAGTTAAAATATATTAGAAATTTTCAGAATTCATAAACTTTAAATTTTAAATTTTGA
CTTCGCTTTGTGTGACTATACAATTACAGAAATTCAGAGTGGCCATTGTTGAAAGAGAGGGTGGAATTTGTAAGTCAAGAAACAGGTTACTCCTG
TTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGTCTTTTTATAATCTTTTTCTACAGAAGAGAAAGTGGGTAATTTTGTTTGAGAGTGGAAAT
ATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAGTAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGAATTG
TTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTTATGGGTTGCTTCTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGGA
ATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGAATTTGGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTA
ATAATGGACGGAAATTTTCTGTACGGTCTGCTATTTTGGCTACTCCATCTGGAGAACGGACGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255393] SGN-U580375 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69119 [Download] [View] Facility Assigned ID: TBFEO75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5