EST details — SGN-E255446

Search information 
Request: 255446Match: SGN-E255446
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34280Clone name: cLEG-30-G11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183541 is on microarray TOM1: SGN-S1-1-6.4.2.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183541 [TUS-42-H3] Trace: SGN-T195077 EST: SGN-E393751 Direction: 3' Facility: INRA
Clone: SGN-C183541 [TUS-42-H3] Trace: SGN-T196082 EST: SGN-E394756 Direction: 5' Facility: INRA
Clone: SGN-C183541 [TUS-42-H3] Trace: SGN-T200357 EST: SGN-E399372 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255446Length: 527 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255446 [] (trimmed) CTAAAATGGCTACTCCTCAACAACCTTTGTTAACAAAAACACACAAACAAAATTCCATAATCAGCTTCAAGATCCTCACTTTTGTTGTAACTTTG
TTTGTTGCTCTCTTCTTAGTTGTGTTTCTTGTTGCTCCATATCAATTTGAGATTAAACATTCTAATCTGTGTAAAACTGCACAAGATTCCCAACT
CTGTCTCAGTTATGTTTCTGATTTAATATCCAATGAAATTGTCACATCTGATTCAGATGGACTAAGTATTCTGAAGAAATTTTTAGTTTACTCTG
TTCATCAAATGAACAATGCAATTCCAGTGGTTCGCAAAATCAAGAATCAGATCAATGACATTCGTGAACAAGGGGCTTTAACTGATTGTCTTGAG
CTTCTTGATCTGTCAGTTGATTTAGTATGTGATTCAATTGCAGCAATTGATAAGAGAAGTCGTTCGGAGCATGCCAATGCGCAAAGTTGGCTAAG
TGGTGTGCTTACTAACCACGTTACGTGCTTGGATGAGCTTGATTCCTTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255446] SGN-U563073 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69172 [Download] [View] Facility Assigned ID: TBFEM42THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5