EST details — SGN-E255508

Search information 
Request: 255508Match: SGN-E255508
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34268Clone name: cLEG-30-F17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177189 is on microarray TOM1: SGN-S1-1-6.3.8.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177189 [TUS-25-O11] Trace: SGN-T181625 EST: SGN-E369763 Direction: 3' Facility: INRA
Clone: SGN-C177189 [TUS-25-O11] Trace: SGN-T181626 EST: SGN-E369764 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255508Length: 615 bp (841 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255508 [] (trimmed) ATTGGTGTGGAGGTTCATCCACTAGACTTCTTCACAAATTGTGGGAAAATTCGCTTTTATTGCTGGGATACAGCTGGACAAGAGAAGTTTGGAGG
TCTCAGAGATGGTTACTAGTAAGTGATTCTAGACAGTTGAAACTTTTAGTTTCGGTGCTCTGTTGCTTGATGATAAAAACTTGTACTATCAAATC
CTTAAGAGTTAAATGTGTAAAGTTTCATGTTTCCAAAAGATGAAATATTGGTATTATGGTATGCTGGTTTGTTCTGATAATGAAGAATTATTTGA
TAACCGGTGGTGTTCTACATCAAATGTCATTATAGGTATTTCTACAATGTGGTCTCATATCTCAGGCTATAATAGCTGAGGTGACAGTAATTGTG
CTCATACCTGCGTCTCTTTTGAGCACATAATACCATAATTACCCTGCCACTCCTTTTTTTAGATCAAACACATGTTTGACTGCCTTGACATTAAT
TGTCTTGCTTGAAGCTTTCGGTGATTGTATTTTGGCTTCTCATGTTTCTCTATATCAATCGTGCAGCATTCATGGGCAATGTGCAATTATCATGT
TTGATGTTACAGCTCGTCTGACCTACAAGAATGTTCCTACTTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255508] SGN-U579056 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69234 [Download] [View] Facility Assigned ID: TBFEO33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5