EST details — SGN-E256261

Search information 
Request: 256261Match: SGN-E256261
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C36234Clone name: cLEG-37-P3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C185168 is on microarray TOM1: SGN-S1-1-3.3.11.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185168 [TUS-46-K22] Trace: SGN-T199070 EST: SGN-E397744 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E256261Length: 625 bp (729 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E256261 [] (trimmed) GGACCTGGTTGCTCTGCTCTATCTGGCCTTATCTATGAGATTGGACCAATAACATTTGGGGCAGTGGAATACAATGGGAGTTTGCCTACAATGAT
ACTGAATCCTTACTCATGGACAAAGGTGTCAAGTATTATTTTCTTAGACTTACCGGTAGGAACTGGTTTTTCCTACGCGACAACTCCAGCAGCTC
TACAAACATCTGATTTACAAACAAGTGATCATGCATATCAGTTCCTTCGCAAGTGGTTTGTAGATCATCCAACATTTCTAAAGAATCCATTATAC
ATTGGTGGAGACTCGTACTCGGGGATGGTTGTTCCCATTATTAGTCAAATTATTGCCAGTAATAATGAAATGGAAATCAAACCATTTATCAATCT
CAAGGGATATTTACTCGGAAATCCATCGACATTTGAAGGTGAAAACAATTATGAGATTCCATTTGCTTATGGAATGGGACTTATTTCTGATGAAC
TCTATGAGTCTTTGAATACCAATTGTAAAGGAGAATACATTAATATAAATCCAAGCAATTTATTGTGTTTGCAAGATGTTCAAACTTTTAAAGAG
CTTCTTAGAGGAATTAATAAACCCCATATTTTGGAGCCCAAATGTAAGCGCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E256261] SGN-U585997 Tomato 200607 Build 2 62 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70745 [Download] [View] Facility Assigned ID: TBFFQ86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5