EST details — SGN-E259041

Search information 
Request: 259041Match: SGN-E259041
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37356Clone name: cLEG-41-M9
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177396 is on microarray TOM1: SGN-S1-1-7.4.7.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177396 [TUS-26-H2] Trace: SGN-T182714 EST: SGN-E370100 Direction: 3' Facility: INRA
Clone: SGN-C177396 [TUS-26-H2] Trace: SGN-T182715 EST: SGN-E370101 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259041Length: 420 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259041 [] (trimmed) CAGGGATGCAGTTGAACCTGTTCTCCTGAACCTTTCTATACGTCTTCGGAATCTCCAAGAGTGCATGAATGAGAAGATACGAGCCAATGCTTATG
CGGCATTTGGAGCACTGAGCACTTACGGATCTGGGCCTCAGCAAGACTCTTTTCTTGAGCAGGCTCATGCTGCTTTCCCACGGATGGTTTTACAT
CTACATGAGGATGATCTTAGTGTGAGACAAGCTTGCCGAAACACTTTGAAATCCATTGCTCCCTTGATGGAAATTGATGGAATAACTGCTGTTTT
CAACAGTCACTGGTTTAGTTCGGACCATCGAGGCGACTATGAAGACTTTCTTCGAGAACTTGCAAGGCAACTAACTCAAAATCTTGCTGCCCGAG
TAGATAGGTACATGGCATCAATAATACAAGCATTTGATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259041] SGN-U585770 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72073 [Download] [View] Facility Assigned ID: TBFGE77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5