Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E264078

Search information 
Request: 264078Match: SGN-E264078
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C43773Clone name: cLEG-64-K19
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188641 [TUS-55-L15] Trace: SGN-T352062 EST: SGN-E551187 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E264078Length: 435 bp (919 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E264078 [] (trimmed) TACCGTTCAACGGCATAATTTTGCGGCTAAAAAATGCGAGCCATAATATAATGGCATTACAAACCCTAGTCATGTCATCATCATCTATTTCTCTC
TTGCATCTTTCTTCCCTTTTCTCTTTTACCCATTTCTTCCTATTTTAGGGTTAGGGTTCCTCTTTCTCATTCTTCTTGTTTGTTTATCTTCATTA
TTGTATTGTATGTACAAATGTGTGATTGAAATCAAACTCCCATCAATCTCTATTTTCTCTGTTTATACAACAATCAGGTCTTCTGCAGAAGATCT
GAGAGAGAGGGATACCTACCAAAATGAGCGCATCCAGGTTCATCAAGTGTGTCACCGTTGGTGATGGTGCTGTTGGAAAGACATGCCTCTTGATT
TCCTACACCAGCAATAACTTCCCCACAGATTATGTGCCCACTGTGTTTGACAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E264078] SGN-U580210 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T78289 [Download] [View] Facility Assigned ID: TBFJS70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5