EST details — SGN-E266756

Search information 
Request: 266756Match: SGN-E266756
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49333Clone name: cLEI-7-O19
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188958 [TUS-56-I20] Trace: SGN-T338648 EST: SGN-E537773 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188958 [TUS-56-I20] Trace: SGN-T338650 EST: SGN-E537775 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266756Length: 403 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E266756 [] (trimmed) ACCGTCGGTGTTCAGTTGAATTCATCTCTTCCTTTCAACATTACCAGCAGCAACACGATCGTTTTCCTGAACTGTTCTCAGAGTTTGCTGTCGTC
TCCGCTTAATTGCACTGCTGAGAGTTTGTGTCATACTTACCTGAACGGAACTTCTGAAAATGATGGAGCTATTGGCGCGTGTAGGAACGCGCCGA
TTTGTTGTACGTTTAGGGCAGGTGGATCGTCCACGTCGTATATGATTCGGGTTAAGGAATCGGGTTGTCGGGCTTACCGGAGTTTTGTTAATTTG
AATCCATCGCTACCGGCTAGTAGATGGCCGGAAGCCGGGATGGAATTGCAGTGGGTTTCACCACCGGAGCCGGATTGTACGATTCACTCCGATTG
TGATTCTGATTCGACTTGTGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266756] SGN-U586209 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80981 [Download] [View] Facility Assigned ID: TGSAY94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0163 Quality Trim Threshold: 14.5