EST details — SGN-E268057

Search information 
Request: 268057Match: SGN-E268057
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47125Clone name: cLEI-15-B22
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189183 [TUS-57-C5] Trace: SGN-T339021 EST: SGN-E538146 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268057Length: 532 bp (796 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268057 [] (trimmed) CACACACTTCACTCTTTATACATATCTCAAGAAGAAAGAATTCAAAGCACCAAAACTGATGCTTCTTGTAGCAAATTCAAGTCAATCATGGAACT
TAGCACACCCAACACTGACTTTCTCCCAGAAATGCAAAACACAACAGGACATTGATCAAATTCATGCTCAATTGATAACCACAGGACTTGTAAAA
TATCCATTTCTGACCACAAAACTTATCTTGAAGTTATCTTCTTCCCCTCACACACCCATCGTTGAATTTGCCCGGTTTCTCTTCTTTTCGGCCGA
TTTCTGTTGTTCAAAGCGAAATATAAAAGACCCATTTCTCTGGAATGTGATAATGAAGTCATTTTCACATGGAAATGACCCACATAAGGCTTTTC
AAATGTTCTGTTTGATGCTTGAAAATGGGGTTTTTGTGGATGAGTATTCTATATCTATAGTTTTGAAAGCGTGTTCCAAAATGGGTTTTATAACG
CGAGGAATGCAGGTTCATGGGTTATTGAGGAAAATAGGATTTGGGTCTGATGTGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268057] SGN-U570966 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83004 [Download] [View] Facility Assigned ID: TGSCH11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5