EST details — SGN-E268114
Search information |
Request: 268114 | Match: SGN-E268114 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C47303 | Clone name: cLEI-15-M15 |
| ||
Library Name: cLEI | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: whole seedlings
Development Stage: germinating seed
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E268114 | Length: 217 bp (710 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E268114 [] (trimmed)
GAATCAAGCAGTATTCAAGTCAATGGAATGCAATTTTCATATGATTTTCAAAGTCCCATATATTTCGATTTCAATCTCAATGTTGCTCCCAGATC
TCGATGTCTTCTTCTCGGTGCAAATGGATCAGGGAAAACGACCCTTTTGAAGATATTGGCCGGAAAACATATTGGCCGGGGAAAAGAAGTAGTCA
GGGTGCTTAATTTATCGGCTTTTCATG
TCGATGTCTTCTTCTCGGTGCAAATGGATCAGGGAAAACGACCCTTTTGAAGATATTGGCCGGAAAACATATTGGCCGGGGAAAAGAAGTAGTCA
GGGTGCTTAATTTATCGGCTTTTCATG
Unigenes |
Current Unigene builds | |||||
[SGN-E268114] | SGN-U588319 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T83061 [Download] [View] | Facility Assigned ID: TGSCE80TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.932 | Expected Error Rate: 0.0175 | Quality Trim Threshold: 14.5 |