Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E268507

Search information 
Request: 268507Match: SGN-E268507
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C46851Clone name: cLEI-13-O13
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177652 is on microarray TOM1: SGN-S1-1-7.2.6.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177652 [TUS-27-B18] Trace: SGN-T193252 EST: SGN-E391926 Direction: 3' Facility: INRA
Clone: SGN-C177652 [TUS-27-B18] Trace: SGN-T197832 EST: SGN-E396506 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268507Length: 595 bp (839 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268507 [] (trimmed) GTTTCATATTGATGGTTTTGTTTTTGTTAACGCTTCGTCCTTGTTGAGAGGGTTCAATGGAGAGATTCTATCTCGTCCTCCATTAGTTGAAGCTA
TTGCCTTTGATCCTATCCTTTCAAAGGTCAAGATGATTGCAGATAATTGGAATCCATTAACCAATGATTCTACGGAAAATTTATTCCCTCACTGG
AGGAGATGGGCAGAGATAAATATGAGATTTTGTGATGACATTCGAGACTTCTTGAGAGGTGAGGGTCTTCTAAGCAATTTAGCAACACGACTTTG
TGGAAGTGGGGATATCTTCGCAGGTGGACGAGGCCCTGCATTCTCTTTCAATTATATCGCCAGAAATTCTGGACTTACACTTGTTGACCTGGTTA
GCTTCAGTAATAGTGAAGTGGCTTCAGAGTTAAGTTGGAATTGTGGACAAGAAGGCGCCACGACTAATAGTATTGTCCTAGAGAGACGACTTAAA
CAAGTTCGTAATTTTCTGTTCATATTGTTCATTTCTCTAGGTGTACCAGTACTTAACATGGGAGACGAGTGTGGTCAGTCTTCCAGAGGTTCCCC
AGCATATGATGCTCGAAAATCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268507] SGN-U564514 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82568 [Download] [View] Facility Assigned ID: TGSBW91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5