Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E268595

Search information 
Request: 268595Match: SGN-E268595
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C46841Clone name: cLEI-13-N3
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177649 is on microarray TOM1: SGN-S1-1-2.2.6.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177649 [TUS-27-B15] Trace: SGN-T183125 EST: SGN-E370888 Direction: 3' Facility: INRA
Clone: SGN-C177649 [TUS-27-B15] Trace: SGN-T183126 EST: SGN-E370889 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268595Length: 540 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268595 [] (trimmed) GGAAAGTCAAAAGTAGAGTCAGCTGCTGCTACTTGTCGCTCGATCAACTCTTCCACTCAGATTGTGGAGCACAGAGAAGCCTTCCGCACGTCCAA
TGCTTTGGAAATTGTGAGCAAATATGATGTGGTAGTAGATGCAACAGACAATGCTCCAAGCCGCTACATGATCAATGATTGCTGTGTTGTGCTTG
GGAAGCCTCTTGTATCTGGAGCTGCTCTAGGACTAGAAGGGCAGCTGACGGTTTACAATTACAATGGAGGTCCATGCTATCGATGCCTATTTCCA
ACTCCTCCACCCACAAATGCTTGTCAGAGATGTGCTGATAGTGGTGTACTTGGAGTTGTTCCAGGTGTTATTGGATGTCTTCAAGCCTTAGAGGC
CATAAAGGTTGCTAGCTTGGTTGGAGAACCACTCTCCGGAAGAATGCTTCTTTTGGATGCGCTGTCAGGCCGGTTCCGTAATGTCAAACTACGTG
GAAGGTCATTGCAGTGCGAAGCTTGTGGAGATGATGCAGTACTGACAAGGCAGACATTTTCGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268595] SGN-U569658 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82656 [Download] [View] Facility Assigned ID: TGSBY74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5