EST details — SGN-E26928

Search information 
Request: 26928Match: SGN-E26928
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7392Clone name: cLEC-38-M17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174234 is on microarray TOM1: SGN-S1-1-1.4.16.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7392 [cLEC-38-M17] Trace: SGN-T31486 EST: SGN-E208951 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E26928Length: 536 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E26928 [] (called/trimmed by facility)
CTCTCGAGCTCCTTCAAACGCAGTAGAAGCTGAAAATGACGCTTGGAGAAAGGCAAGGAGATGAGAAAAATGACTCAAAGTACTGCGGAGTTGAA
ACGGAGTTCAATGATGACATGCCTCAACTTCTCTCCCTCAACATTCATGGAGGATTCGACTTTGTTGTCGCACCATTGATGGATCCTGCTTACAG
GCCTAGTTTACTGGTGAGTAGCAATGGTGGATCTGGGGTTCTTCCATTCGCTGGGTCAGACTTGGTGCTAAGCCCTTCCCAATGGAGTAGTCATG
TTGTTGGTAAAATTAGCTCATGGCTTGACTTGGATTCTGAGGATGAAATGTTTCGGAGGGATTCTGAGATTACTTTGAAACAAGAAATAGCCTGC
GCTTCTCACCTTTCACTGCAGGCCTGTCTTCTTCCTGCACCCAAGGGAGTGACCTGTGCTAATTATGCTAGATGTGTGAATCAAATTCTACAGAA
TCTAAGCAATATGCAGTTGTGGCTAAGAATTCCATTGGAGAAATCTGATGATGATGAAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T31486 [Download] [View] Facility Assigned ID: TCAFS81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence