EST details — SGN-E270282

Search information 
Request: 270282Match: SGN-E270282
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62111Clone name: cLEM-1-I10
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177766 is on microarray TOM1: SGN-S1-1-5.3.6.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177766 [TUS-27-G12] Trace: SGN-T183014 EST: SGN-E370639 Direction: 3' Facility: INRA
Clone: SGN-C177766 [TUS-27-G12] Trace: SGN-T183015 EST: SGN-E370640 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270282Length: 381 bp (698 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270282 [] (trimmed) AGAAAATCAGCACAACTTCAACTTCAGTTTCTGCTCCCAAGAACCAAACCAAATCAACCAATAACTCTTCTAAAAATCAAACCAAGCAAATCAAG
ACTTCCTCTTCTTCTAGTTTTGGTTCTACCAAGAACCAAACCAAGCTTTCAAAATCAAAACTTCCCATTTCTGAATCACAAACCAAGCCTAGTTC
TACCATTACCAAATCAGAGAAATTTACATTCAAATCCCAGCTTCAAAAGCTCAATCTCACTCCCTCCAAGTCCTCAAATTCAACCAAGATCACTT
CTTCCACCTTCAAAAAGTCCTCAGATCTACCCAAAATCAGCTCAACTTCTTCTCCCAAGAACAAAACAATCAAATCAACTAATACCCAATTGGAA
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270282] SGN-U585499 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83655 [Download] [View] Facility Assigned ID: TGFAB53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0247 Quality Trim Threshold: 14.5