EST details — SGN-E270594

Search information 
Request: 270594Match: SGN-E270594
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67661Clone name: cLEN-1-K17
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67661 [cLEN-1-K17] Trace: SGN-T87898 EST: SGN-E270593 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270594Length: 452 bp (815 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E270594 [] (trimmed) ATAGCAAGCACATACTTTATAAATTATATTACATTGCTTAGAAACGTGAAAGTATTTAACTCAAACATTTGCTTCAAATTCAAAGGTACAATCTG
CAGAAGTATAAATAGTAATAATAGATAACATTATTATTCTTATTCTTAGATCTTGTAACGGGACAATGCAGAAGTTCCATCTAGGCCTCTGTTAT
GGAGGTAACTAGTGTGGTCTTTCACTGTGGTTGCGCGATATTTTGGAGGATTATCTTCTGATAACAATTCAGTTATCGGTCCATAAAGCTTGGAA
GATTGATATGGACTTTCACCGAAGAAGCACGTGATTGACATTCTTGATCCAACATTGTTTGAGATTGCTCTGTGCTCGACACTTAAGTACTTGTC
ATTTGACAAGAGCTGCAAAAAATAATTAAAAAAAAGATTTTCTGCAGAAAATCTCCAATATTCACCACTAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270594] SGN-U580097 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87899 [Download] [View] Facility Assigned ID: TRRAA69TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5