Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E271254

Search information 
Request: 271254Match: SGN-E271254
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64357Clone name: cLEM-5-O20
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177975 is on microarray TOM1: SGN-S1-1-4.4.6.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177975 [TUS-27-P5] Trace: SGN-T183191 EST: SGN-E370954 Direction: 3' Facility: INRA
Clone: SGN-C177975 [TUS-27-P5] Trace: SGN-T183192 EST: SGN-E370955 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271254Length: 380 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271254 [] (trimmed) GGAGAAAAGGACAGAAGGAAGGTCACTGTTTTTCCCCCAAGAGAGAGAGAGAGAGAGGCATTTGTCACTCTAAAGTCCCAACAGTCCAAACAGAG
CTGAGCTGCGGTGGTGTGGCGGAGGACGGTGGAGAAAAATTGTGATGGGCGTTTCACAGAGCAACAACAGAAGAAGAAATCATAGCTGGAATGCT
TATTATTACTACCCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTACTCTTACTACTCCTCTGACCCTCCTTACCACCCCCACCCTCCACCCCCTTT
CCCTTTTGCACCTCATCTCCTCCCACCCCCACCTTCTTATTCCTACCCCTCTACCTGCCACTGCACTAATCCTGTAGTGGGTAAGTTTGTTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271254] SGN-U582147 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85059 [Download] [View] Facility Assigned ID: TGFAR94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5