Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E271408

Search information 
Request: 271408Match: SGN-E271408
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64268Clone name: cLEM-5-K14
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177930 is on microarray TOM1: SGN-S1-1-1.2.6.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177930 [TUS-27-N8] Trace: SGN-T193291 EST: SGN-E391965 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271408Length: 439 bp (884 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271408 [] (trimmed) GATTGGGAGTACCATACTCTCTCCTTATGTAGCTAAGTTAACTCACACTTGCAGCCTCTACACAACCGTTGAGCAAATATCCTTTTCCACTCTTC
TTTAGCTCTCCTCTCTCTCTGTTCCATGTTTCTTTTTCTGCTGATGGAGGAGCTCTACTGTCATCTCAGTTGACGACCAAGACTTCATTTTTATT
AACTTTCTGTATTTGGGTTGCAAGCTATTCTGGATCTGTTCTTGACCCTTTTCGTTTTTGCTGATTTTAGTGGCTAGGAGGGTATATATTCGAGG
TAAACAAATCTGGGTCGACGTGTTCTTGAAGTTTCATCTCATGGTTTGACTGATTATTTTTGCTCCAGTGAGTCATTTGGCAAATGGGTCGAGGT
AGAGGAAAGGGTAAGAAATTGACTGATGATCCAGGAAGTGATGAGGAAGAAAAGATCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271408] SGN-U568795 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85213 [Download] [View] Facility Assigned ID: TGFAR67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5