EST details — SGN-E271467

Search information 
Request: 271467Match: SGN-E271467
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64176Clone name: cLEM-5-F4
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177876 is on microarray TOM1: SGN-S1-1-7.4.6.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177876 [TUS-27-L2] Trace: SGN-T193035 EST: SGN-E391709 Direction: 5' Facility: INRA
Clone: SGN-C177876 [TUS-27-L2] Trace: SGN-T193284 EST: SGN-E391958 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271467Length: 514 bp (622 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271467 [] (trimmed) GGCTGTTCAAAGGAAGATTGCAGATTTACAAGTGGAACTTCAAGGTCGAAAGGAGGACAAAAATGTTGCTCATCTGACACATGTCAGTGAAATGG
AAAAGAAGATTGAAACATTGCAAAGGATTACTACTATTTTGAAGGATGTTATTCAGAACAAGGACCGCATAATTGCTCGCCTTCAACAACCATAT
TCATTGGATTGCATTCCCGTTGAAGCTGAATATCAGAAACAATTTTCAGAATTGCTGATGAGGGCTGCCAGTGATTATGGAGCTTTGACGGCCTC
CGTAACAGATTTTCAGTGGAGTCAGAATTTTAAAGAGCCACCAACAGTATGGGGGGAAATGCTTCGTCCAATTCCTGTTGCTTTGGCTTCCAGCA
CCCGGTTCTTTGAAGCCATGTCTGCTATGAGAGAGTCAATTGCAACACTGCATGCTTTGAGAGTTGGTCATTCTTCTTCCTTGTCTACAACACCA
AGCAATGATCCTTCTCAAACAACACTTGGAGATACTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271467] SGN-U574489 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85272 [Download] [View] Facility Assigned ID: TGFAT26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5