EST details — SGN-E271759

Search information 
Request: 271759Match: SGN-E271759
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65043Clone name: cLEM-8-C23
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178237 is on microarray TOM1: SGN-S1-1-6.3.4.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178237 [TUS-28-K3] Trace: SGN-T183310 EST: SGN-E370383 Direction: 3' Facility: INRA
Clone: SGN-C178237 [TUS-28-K3] Trace: SGN-T183311 EST: SGN-E370384 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271759Length: 655 bp (842 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271759 [] (trimmed) GCACAAATCATAATGATAACTCATGGGCGCCACTGCCTCTGCTGGGTCACTCACATCTGCTTTTGTTCCTCCTCAAGGATTTAATGGATCATCTA
AGAGCTTACAATGGAGAACCCAAAAGAAACAATTTGGAAGAAAAGCTGGCTCTGCTACAATAACAGCTAAATTTGACCTCATCCCTCCTCCTTAT
CCAATGGATGCTTTGGAGCCTCATATGAGTAGTAGAACATTTGAATTCCACTGGGGGAAGCATCACAGGGCGTATGTCGACAACTTAAACAAGCA
AATTGATGGAACAGAATTAGATGGAAAGACACTAGAAGATATAATACTTGTTACATATAACAATGGTGCTCCCCTTCCAGCATTCAACAATGCTG
CTCAGGCCTGGAATCATCAGTTCTTCTGGGAATCTATGAAGCCCAACGGAGGAGGAGAGCCATCCGGTGAATTATTAGAACTAATAAATAGAGAC
TTTGGTTCCTATGATACATTTGTTAAAGAATTTAAGGCAGCTGCAGCAACACAATTTGGCTCCGGATGGGCCTGGCTTGCATACAAACCTGAAGA
CAAAAAGCTTGCTCTAGTGAAAACTCCTAATGCTGAAAATCCTCTTGTTTTGGGATACACACCACTCCTCACCATCGACGTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271759] SGN-U578588 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85310 [Download] [View] Facility Assigned ID: TGFBC24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5