EST details — SGN-E271817

Search information 
Request: 271817Match: SGN-E271817
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65123Clone name: cLEM-8-G18
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178284 is on microarray TOM1: SGN-S1-1-7.1.4.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178284 [TUS-28-M2] Trace: SGN-T183382 EST: SGN-E370192 Direction: 3' Facility: INRA
Clone: SGN-C178284 [TUS-28-M2] Trace: SGN-T183383 EST: SGN-E370193 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271817Length: 500 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271817 [] (trimmed) GGAGTTTGTAAGCTTATGCCCCATACACATGCTTGTTCTACCCTTCTGAATTCATTGGTCAAGGATGGGTTGACTGATACTTTGTGGAAAATTTA
CAAAAAGATGCAAAAAATAGGGGTCCTTCCAAATATCTATATCTATAACGTGCTTATGCATGCCTGTTGTAAGTCTGGTGATGTAGAGCGGGCTG
ATGATTTATTGAGAGAAATGGAGTTTAAAGCTACACTGCCTGACCTTTACACTTATAACACATTGATATCATTGTACTGCAAGAAAGGCATGCAT
TATGAAGCTTTGTGCGTGCACGATAGGATGGAAAGAGCAGGAGTATGTCCTGATATTGTAACCTATAATTCCTTAATTTACAGTTACTGCAGGGA
AGGGAGGATGAGGGAGGCTATGAGACTTTTCAAGGAAATTAAAGGTTCTACGACTAACCTGGTTACTTACACCACATTGATAGATGGATATTGCA
CAGCCAACAATGTTGCTGAAGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271817] SGN-U563504 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85368 [Download] [View] Facility Assigned ID: TGFBD45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5