EST details — SGN-E272023

Search information 
Request: 272023Match: SGN-E272023
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65153Clone name: cLEM-8-H3
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178301 is on microarray TOM1: SGN-S1-1-6.1.4.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178301 [TUS-28-M19] Trace: SGN-T183324 EST: SGN-E370397 Direction: 3' Facility: INRA
Clone: SGN-C178301 [TUS-28-M19] Trace: SGN-T183325 EST: SGN-E370398 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272023Length: 580 bp (962 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E272023 [] (trimmed) GGCCAGATACTAACAACTCTTGGTACAATAAGACCATGACACTCGAAGGATGTAGGCAAGTATGCTCAACAAACTGTTCTTGCATAGCATATTCG
AGCCTAGATATAAGCAATGGAGATAAAGGTTGCTTGTTTTGGTCTGGTGAGTTGATTGATATCAGAGAGCTCTCTGGAAGAGGTCAAGACATTTA
CATACGAATGGATTCTTCAGACCTAGTTTCTCAGGCAAGTTCAAACAGAAATAAGACAGGGATACTCGCGGTGAGTTTCTCAGTTTTGGTGGCAA
TGATTCTGCTAGGCCTGATTCTGTTTATGTACATACGTAAAAAGAGGAAACTAAAACTCAAAGAGGATTTTGAGTTGCCACAGTTTCAACTGTCG
ATAATAACAAGAGCCACAGATAACTTTTCGGTCAACAATCAGATTGGAGAAGGTGGATATGGACCTGTTTATAAGGGAGTACTCGAAGAGGGACA
AGAAATTGCTGTGAAGAGACTATCAAGGACTTCCATGCAAGGAATTGATGAATTCAAGAACGAAGTTACCTATATTGCCAAGCTTCAGCATAGAA
ATCTTGTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272023] SGN-U577920 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85574 [Download] [View] Facility Assigned ID: TGFBE38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5