EST details — SGN-E273693

Search information 
Request: 273693Match: SGN-E273693
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68551Clone name: cLEN-6-N8
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183431 is on microarray TOM1: SGN-S1-1-4.3.1.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T194915 EST: SGN-E393589 Direction: 3' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T194915 EST: SGN-E399133 Direction: 3' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T194916 EST: SGN-E393590 Direction: 3' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T194917 EST: SGN-E393591 Direction: 5' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T199568 EST: SGN-E398242 Direction: 5' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T199568 EST: SGN-E399554 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273693Length: 359 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E273693 [] (trimmed) AAAACATGTAAATGGTTTTACTGTGGCCTATTGTTTTTTCACCTTTCCCAATTATAAATATCCACTGCCTCAACTGAGTAAACAACCAAAATTTG
TGTTCTATAAAAAGTTTTCATATTTAGTGATCACTAAAAAAAAATCAAGAAGATGTCGACTACTGTAGGCCAAGTCATTCGTTGCAAAGCTGCTG
TGGCATGGGAAGCTGGTAAGCCATTAGTGATGGAGGAAGTAGATGTTGCTCCTCCACAGAAAATGGAAGTCCGTCTTAAGATCCTCTATACTTCA
CTCTGTCATACTGATGTATACTTCTGGGAAGCTAAGGGTCAAAATCCAGTCTTTCCTCGAATTCTTGGACATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273693] SGN-U579420 Tomato 200607 Build 2 345 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88389 [Download] [View] Facility Assigned ID: TRRAX76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0137 Quality Trim Threshold: 14.5